90
|
ASHRAE Inc
ashrae 93 standard Ashrae 93 Standard, supplied by ASHRAE Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/ashrae+standard+93+2003/10__1016_slash_j__aej__2015__12__029-44-8-7 Average 90 stars, based on 1 article reviews
ashrae 93 standard - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Caswell Inc
electrolytic copper plating bath bright acid copper bath Electrolytic Copper Plating Bath Bright Acid Copper Bath, supplied by Caswell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/copper+electrolytic+plating+bath+bright+acid+copper+bath/us07976692-139-14-23 Average 90 stars, based on 1 article reviews
electrolytic copper plating bath bright acid copper bath - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
86
|
Instron Corp
mas Mas, supplied by Instron Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/mas/pm42144420-52-52-44 Average 86 stars, based on 1 article reviews
mas - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
99
|
ATCC
bhk cells  Bhk Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/BHK-21/pmc10040388-286-84-86 Average 99 stars, based on 1 article reviews
bhk cells - by Bioz Stars,
2026-11
99/100 stars
|
Buy from Supplier |
90
|
Moses Lake Industries
electroplating suppressor hsl-b Electroplating Suppressor Hsl B, supplied by Moses Lake Industries, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/hsl+pt1/us09617648-372-22-27 Average 90 stars, based on 1 article reviews
electroplating suppressor hsl-b - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
86
|
Instron Corp
electropuls e1000 machine Electropuls E1000 Machine, supplied by Instron Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/machine/10__2341_slash_1559___2863___41__5__453__a-1351-13-16 Average 86 stars, based on 1 article reviews
electropuls e1000 machine - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
90
|
BetaTech GmbH
b-10 electropulsator B 10 Electropulsator, supplied by BetaTech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/electropulsator+s20/pm30632408-50-9-12 Average 90 stars, based on 1 article reviews
b-10 electropulsator - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
86
|
Instron Corp
electropuls e10000 axial torsional test system Electropuls E10000 Axial Torsional Test System, supplied by Instron Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/e10000+instron/10__1111_slash_ffe__70131-145-9-8 Average 86 stars, based on 1 article reviews
electropuls e10000 axial torsional test system - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
90
|
Verlag GmbH
electroplating of cu Electroplating Of Cu, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/cu+electroplating/pm31183907-132-10-5 Average 90 stars, based on 1 article reviews
electroplating of cu - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Metalor Technologies SA
cyanide-free gold electroplating solution metalor ecf 60 Cyanide Free Gold Electroplating Solution Metalor Ecf 60, supplied by Metalor Technologies SA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/electropuls+10+kn+servo+electric+load+frame/gold+plating+solution+ecf+60/10__1039_slash_C5NR06157A-137-9-13 Average 90 stars, based on 1 article reviews
cyanide-free gold electroplating solution metalor ecf 60 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
N/A
|
High speed bright copper electroplating solution is an electrolytic acid copper process engineered for plating copper bumps, pads, patterns and redistribution layers as well as filling vials and trenches on wide varieties of substrates including
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports Medicine
Article Title: Emergent variant modeling of the serological repertoire to norovirus in young children
doi: 10.1016/j.xcrm.2023.100954
Figure Lengend Snippet:
Article Snippet: Briefly, capsid encoding genes were prepared for insertion into the VEE cDNA plasmid pVR21 by Apa 1/ Asc 1 (both NEB) digestion and ligation by the addition of GGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAG at the 5-prime end and an Asc 1 site at the 3-prime end. pVR21 containing norovirus capsid gene pDNA was purified with QIAprep Miniprep kit (Qiagen), linearized with Not I (NEB), gel purified with QIAquick Gel Extraction kit (Qiagen) and capped mRNA produced using the mMESSAGE mMachine T7 transcription kit (Invtirogen). mRNA was electroplated into
Techniques: Virus, Recombinant, Protease Inhibitor, Reverse Transcription, Modification, Software